Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST231019
Clone ID OST231019
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST231019
Sequence
ACCTGAGGCTGGTTGNAGCTTGTGACGTAANCAGCNTGTAACANGAAGCCATGATNNCNTCTTGCNGTATTATNAGAAGT
CTAACGGCTANGCANGANTNTGANCCATNTNTGNTACCTGCNTCGCTAANCANAACTCTCCAGTTNNTANNCNGNGANAN
CAGAGCCTGCTAGNACCCCGCCACAAGGCTCCATGGCCTATAGCACCACCGTGGGGAAGATAGCAGGCACTCCTGGGACA
GGTGGTCGTCTCAGCCCTGAAAACAACCAGGTATTGACCAAGAAGAAATTACAAGACCTAGTAAGAGAAGTAGATCCTAA
TGAGCAGCTGGATGAAGATGTGGAAGAGATGCTGCTACAGATCGCTGATGATTTTATTGAGAGTGTGGTGACAGCTGCCT
GCCAGCTTGCTCGGCACCGCAAGTCCAGCACCCTAGAGGTAAAAGACGTCCAGCTGCATCTAGAGCGCCAGTGGAACATG
TGGATCCCAGGCTTTGGCTCTGAGGAAATCCGACCCTACAAAAAAGCATGTACCACAGAGGCTCACAAACAGAGAATGGC
ACTGATCCGGAAAACAACCAAGAAATAACACAGGGAACGGTCAGGGGAATGGACAACGTGTATTTGGAGATACTTGAGCT
GAGACCTCAGCCATCTCATCCTTGGATTNTTTTTTTAAATGCTTTACAGGAGAAACANTATATTTTTTTTTTAACAGGGG
CAGCAATATCTTTTAATGACT
Sequence Type mRNA
Unitrap ID UNI16877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131838729..131848723 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es