Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST230929
Clone ID OST230929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST230929
Sequence
GAGAAGCTGCTACTCGAAACATGGAGAAGATACAGGNCATCANGGACTTCCCATGGANCCTGGCAGATGAACAGGATGTC
CNCATGCACGACCCCCGCTTGATACCCCTAAAAACCATGACGTCNGACATTTTAAAGATGCAGCTCTACGTTGAAGAGCG
AGCGCATAAGAACAGCTGAGGACATGCCTGTCACCAGCTACCCAGCTGTCCCACTACGGGGCCCCAGCCCGGGGCCCCAG
ACTCCAAGTGCTCTTATTGCCTTGACATGNGGCTGCCCCTCTGGTCAGGCTGCCCAGCCCTGCTTGCCTTCGTGAGGCAG
CCTTCCCAGGAGCTGGGGAAGGATGCGAGGACACNCGCCNTTTCTCAGCAGCCTTCTGGGCTGAGCTGGCTAACATTGTC
CACTGTGCCATGCGTTATTGTTAATAANGNGGCCCCAAGGGCTGACTACTC
Sequence Type mRNA
Unitrap ID UNI24208

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147518793..147519792 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029003 (Mad2l2) NM_027985 MAD2 mitotic arrest deficient-like 2 (yeast) Gene [Source:MGI (curated);Acc:Mad2l2-001]

 
Come back to gene ENSMUSG00000029003


For any suggestions or comments, please send an email to unitrap@crg.es