Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST230674
Clone ID OST230674
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST230674
Sequence
GATTGATGGACACTTTTCTTAATNAACACCTTTTGATTCTTCGAGAACAAATTGCTCCATTTCACACTGAATTCACCATT
AAGGAAATTTCCCTGGACCTCAAGAAAACTAGAGGTATCAGCATTGAAAACCATGGCCAGCCAGGGAGGCCCCAAGTACA
CCCTCTCACAGCAGCCGTGGGCACAGCCAGCAAAGGTCAATGACCTCGTGGCCACTGCCTACAAGACAATAAAGACGAAG
CTGCCGCTGACACTGAGAAGCATGGCTTTGTGTTTGTCCAATAAGGACACGGAGTTCATCTTGTTTAAGCCTGTCAGGAA
TAACATTCAGCAAGTCTTCCAGAAGTTCCACGCTCTGCTAAAGGAAGAGTTCAGTTCTGAAGACATCCAAATCATTGCTT
GTCCTTCCATGGAACAGGTACCCACAGACCCACAGACAGAAGGCCTGATGGCCTTAGGCCTGTGATTATTTTACTTGAGC
AGATAGTATGTTTAAGCAAACATGTTTCTATTTTTTAAGTTCACAACTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76106785..76119614 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034893 (Cog3) NM_177381 component of oligomeric golgi complex 3 Gene [Source:MGI Symbol;Acc:MGI:2450151]

 
Come back to gene ENSMUSG00000034893


For any suggestions or comments, please send an email to unitrap@crg.es