Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0045
Clone ID CA0045
Vector pGT0lxf*
Project sanger

Sequence tag CA0045
Sequence
AGGCTTCTGGTTTTTGCTACGGTTTCTGATTTCGGCTNTGGGATGGGTTGCGACGGAGGCACCATCCNCAAGAGGCACGA
GCTGGTGAAGGGGCCGAAGAAGGTCGAGAAGGTTGACAAAGACGCTGAACTGGTAGCCCAGTGGAACTACTGTACCCTAA
GTCAGGAAATCCTGAGGCGCCCAATAGTTGCCTGTGAGCTTGGCAGACTGTATAACAAAGACGCGGTCATCGAGTTTCTG
TTGGACAAATCTGCTGAGAAGGCCCTGGGGAAGGCGGCATCGCACATCAGAAGCATCAAGAATGTGACAGAGCTCAGGCT
TTCTGACAACCCCGCCTGGGAAGGAGATAAAGGGAACACCAAGGGCGACAAGCATGACGACCTCCAGAGAGCGCGGTTCA
TCTGCCCTGTGGTGGGCCTGGAGATGAATGGCCGGCACAGGTTTTGCTTCCTCCGATGCTGCGGTTGTGTGTTTTCTGAA
CGCGCCTTGAAGGAGATAAAAGCTGAAGTGTGTCACACG
Sequence Type mRNA
Unitrap ID UNI532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 172266129..172272613 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027502 (2410001C21Rik) NM_025542 RIKEN cDNA 2410001C21 gene Gene [Source:MGI Symbol;Acc:MGI:1913654]

 
Come back to gene ENSMUSG00000027502


For any suggestions or comments, please send an email to unitrap@crg.es