Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH857
Clone ID CSH857
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH857
Sequence
GAGGGCTTGAATCGTAGGAGGAAAAAACGCACCAGCATAGAGACCAACATCCGTGTGGCTTTAGAGAAGAGTTTCATGGA
GAATCAAAAGCCTACCTCGGAAGACATCACATTGATTGCTGAACAGCTCAATATGGAAAAGGAGGTGATTCGTGTTTGGT
TTTGTAACCGCCGCCAGAAGGAGAAAAGAATCAACCCGCCCAGCAGTGGTGGGACCAGCAGCTCACCTATCAAAGCAATT
TTCCCCAGCCCAGCCTCATTGGTGGCAACCACTCCAAGCCTTGTGACAAGCAGTACGGCAACTACCCTCACAGTCAACCC
TGTCCTCCCTTTAACCAGTGCTGCTGTGAGTAATCTCTCTCTTA
Sequence Type mRNA
Unitrap ID UNI5754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 167821944..167826648 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026565 (Pou2f1) NM_011137 POU domain, class 2, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101898]

 
Come back to gene ENSMUSG00000026565


For any suggestions or comments, please send an email to unitrap@crg.es