Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH651
Clone ID CSH651
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH651
Sequence
GCACCGAGAAAGCCAGCCCTCTCTCCTGCCCCGCGGCGGGAGAGCGTGTCCGGCCGGCCGGCGGGGCTCGCGACCCTCCC
GCGCCTCCCTTTCCCCCGCAGCCTCTGCCCCGCCAGGCCCGGCCCGGACCTCCGAGCCCCGGCCTCCTCCTCCTCCTCGT
CCTCGTCCTCCTCTTCGGTCACCGCCGCCTCTGGGCCCCACAGCCCCACCTTGCCGCTTCTCCTTCCATTTTGAGAAGCT
GAGGAAGGAAACAAGGAAAAATGTCGCCACGAAGGCCGAGAACCGCTGCCGCCGCCGACCCCCGCCGGCCCTGAACGCCA
TGAGCCTGGGTCCCCGCCGCGCCCGCTCCGCTCCGACCGCCGTCGCCGCCGAGGCCCCCTTTGATGCCGCAGAGCTCCCC
CAGCGCCGCCGCCACCGCCTCCGACATGGACAAGAACAGCGGCTCCAACAGCTCCTCCGCCTCCTCGGGCAGCAGCAAAG
GGCAACAGCCGCCCCGCTCCGCCTCGGCGGGGCCGGCCGGCGAGTCTAAACCCAAGAGT
Sequence Type mRNA
Unitrap ID UNI409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115722267..115722811 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es