Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST230036
Clone ID OST230036
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST230036
Sequence
CGGCGCCTGTGTTGTCACCNGTATCTGCTCTGCTGAANGAGGACCAAAGTTGAANGANGACGCTNTCCNCNACGTCTGAC
GNTNNNTCTGGCTCTAACCCCTCTNTCANTGCACANGTACCCCGGAAANGTCAGTTCCTGACGACCGTTGGAAGACAANT
TGCCTCCCTGGTCACGACCTGCCTGTGANGACNNGTNGANAGGTGCCTGCCTCNTGTGCNNTCCNGAGAGGGCCCTTCCC
TGTGTTTGTAGTCGCCTGAAGAAGACCTTCCNTNTTCGTCCAGGACTGAGGCGTATGANGCAGCTCAGTTCCTGGCAACC
AGTGCTGGAAATCAGCAGGCTCTGAACTTCACACGGTTCCTCGATCGATCAGGACCTCCTTCTAGAGATGTGAACTCTCT
CGATGAGAAGGTGGCACTGGCATTCANACACCTGAAGCTGCCTGCAGAATGGAACGTGTTAGGGACAGATCACACTTTGC
ATGGTGAGAAGCCACAGACTTACAAGCTGCCTTGGAATACCTCTGCTTTCCCTTTTAAACAACCACTGTGGTTCAAGCCT
CCTCGGTGGCTGAGTAAACTAGAATTCCTAC
Sequence Type mRNA
Unitrap ID UNI654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82724423..82724792 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]

 
Come back to gene ENSMUSG00000078669


For any suggestions or comments, please send an email to unitrap@crg.es