Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST227014
Clone ID OST227014
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST227014
Sequence
ACTGAAGTACAAGTATGGCNATCAGTTCATCTGGATCAGAAGGTTTGAACAGGCCAATGAGTATTGTCATCATCGAGGCA
TTTTATGGAGGCTCCCATCGACAGCTGGTAGAGCTGCTCCGAGAAGAATTAGATGACTGCGTGTTGTACACTCTTCCTGC
AAAGAAATGGCACTGGAGAGCACGCACAGCAGCCTTATACTTCTCACAGAATATTCCCAGCAGTGAGCACTACAGGACCC
TCTTTGCAAGCTCAGTACTCAACCTGACTGAACTGGCTGCCCTTCGGCCTGATCTGGGAAAACTGAAAAAGATCTTATAC
TTCCATGAAAACCAGTTGGTGTATCCTGTCAAGAAATATCAGGAGAGAGATTTTCAATATGGATACAACCAAATTCTCTC
GTGTTTGGTGGCTGATGTTGTGGTATTCAATTCCAGTTTTAATATGGAATCATTTCTTACTTCTATTGGAAAATTCCTGA
AGCTGATTCCTGATCACAGGCCTAAGGATCTGGAAAGCATTATCAGACCCAAGTGTCCTCTTGGAT
Sequence Type mRNA
Unitrap ID UNI24250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44607607..44715846 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036890 (Gtdc1) NP_766250 glycosyltransferase-like domain containing 1 Gene [Source:MGI (curated);Acc:Gtdc1-001]

 
Come back to gene ENSMUSG00000036890


For any suggestions or comments, please send an email to unitrap@crg.es