Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH950
Clone ID CSH950
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH950
Sequence
ATAAGAAGCGTGTGGCAGCCTTGGAAGCCAAGAAAAAGTCCAGCACTTCCCAGAGCCAAGGCCTGACCCACAAAGACCAA
GCCATCGCTGAGCGCCTAGCACGGCTTCGTCAGGAAAACAAGCCCA
Sequence Type mRNA
Unitrap ID UNI5866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119036917..119037033 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068580 (Zfyve19) NM_028054 zinc finger, FYVE domain containing 19 Gene [Source:MGI (curated);Acc:Zfyve19-002]

 
Come back to gene ENSMUSG00000068580


For any suggestions or comments, please send an email to unitrap@crg.es