Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST226830
Clone ID OST226830
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST226830
Sequence
CTGGCACAATATGATCGGTGTTGGAGATATGGTTCTTTTAGAGCCGCTCAATGAGGAGACGTTCATCGACAACCTGAAGA
AGCGCTTCGACCACAATGAGATATATACATACATTGGGAGCGTGGNTATATNTGTTAACCCCTACCGGTCCTTGCCCATA
TATTNCGCCGGNAGAAAGNGGAAGATNACAGAAATAGAATCTT
Sequence Type mRNA
Unitrap ID UNI24253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51920184..51940031 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018417 (Myo1b) NM_010863 myosin IB Gene [Source:MGI (curated);Acc:Myo1b-002]

 
Come back to gene ENSMUSG00000018417


For any suggestions or comments, please send an email to unitrap@crg.es