Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST226248
Clone ID OST226248
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST226248
Sequence
GACTGAGTACAGCGATATTTNGAGAGAAGCCCGAGGTCCCTTTGAGAATGGAGTGATATTTCAAAAATGCTCACTGGTGT
CTGGGCAGAGCGAATCGCAGACCATGCACGTGCAGCTGTCCGTGAACAACACCAGGACGCCCACATCAGTCAACCTTTCG
AACCTGCTCGTGCTAGATGAGATCACCTGGCCTTGCTGTGAAGGAGTCGCCTGGAAATAATACTCAGGATGGAATCCAGA
CTTTCAGAAAGAGCTTTCTGCAAGTGGGAGAATGCTACTCTGTCAGCTACACAGCCTCGCTGGACCCCACAGCCCTTGGG
ACTGGGGAGAGCCTGGATCTTCCTGCCCGGCTCATCTTTCAGAGCCCCTCACAGAACAGAACTCAGCTAAAAGCCCCCTT
TACCATCACAGTGGAAGAAAAGATAATGGTTCTTCCTAACCATGGTCTTCACGCNGCAGGCTNCATCGCAGNCTTNCTCA
TCTCCCTNCTCCNGACCGNGGCAGCCCNGTTCTTNTTGGNGAGGGGTCGATGTCTTAGTTTTTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI24268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37738677..37748745 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050248 (Evc2) NM_145920 Ellis van Creveld syndrome 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1915775]

 
Come back to gene ENSMUSG00000050248


For any suggestions or comments, please send an email to unitrap@crg.es