Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST226026
Clone ID OST226026
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST226026
Sequence
GACTGAGCCCCATGCCAATCACTCGAATGCGGCTGAGACCCTGGCTAGAGCGGCAGCGTAATTCCAACCAAATCCCAGGG
CTGATCTGGATCAATAAAGAGNAGNTGATCNTGCAGTATTCCATGGAAGCACAGCATGCTAAGCACTGGCTGGGACATCA
ACAAGGATGCCTGTCTGTTCCGGAGCTGGGCCATTCACACAGGCCGATACAAAGCAGGAGAAAAAGAGCCAGATCCCAAG
ACATGGAAGGCAAACTTCCGTTGTGCCATGAACTCCCTGCCAGACATCGAGGAAGTGAAGGATCAGAGTAGGAACAAGGG
CAGCTCTGCTGTGCGGGTGTACCGGATGCTGCCACCCCTCACCAGGAACCGNNNNATTNNGANNTNNTTGTTNNNCAACC
GAGACACTANGAGCTNGGCCNANANGGAAGCTGGTGTGGGAGATGTTAGCCCGGACACTNTCTCTGATGGACTCANCANC
CTCTACCCCTACCTGA
Sequence Type mRNA
Unitrap ID UNI24278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53584784..53587625 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018899 (Irf1) NM_008390 interferon regulatory factor 1 Gene [Source:MGI (curated);Acc:Irf1-008]

 
Come back to gene ENSMUSG00000018899


For any suggestions or comments, please send an email to unitrap@crg.es