Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST225528
Clone ID OST225528
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST225528
Sequence
GACTGAGGCACCTGTGACGAGGTCACCTGCCAGCAGATGACCGAGACCAGCCCTTAGTCCTAGGTGTGGTCAAGAGTGTC
TTGGGCTCCAAAGCCTACCTGGACCCTACCACCATGTCAGGATCCACACAGCCTGTGGCACAGACATGGCAGGGCTGCTG
AGCCCCGCTACCCACCCCATGGCATCTCCTACCCGGTGCAGATAGCCCGGTCCCACACGGACGTGGGGCTGCTTGAGTAC
CAACACCACCCCCGTGACTACACCTCACACCTGTCACCCGGTTCCATCATCCAGCCACAGAGGAGGCGGCCCTCACTGCT
GTCAGAGTTCCAGCCTGGGAGTGAACGGTCTCAGGAGCTCCACCTGCGCCCTGAGTCCCGCACGTTCCTGCCTGAGCTGG
GCAAGCCCGACATAGAATTCACCGAGAGCAAGCGCCCCCGCCTGGAGCTACTACCCGATACCCTGCCGCCAGTCCCTCAA
GTTAGNTTTACAATTAAAGNATTTTCTTGTTTTTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125599043..125605352 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es