Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST225522
Clone ID OST225522
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST225522
Sequence
GACTGAGTACACCTATGGCGGTTCTCAGGTGGCTACCCGGCCCTCATGGACTGCATGAACAAGCTAAAAAACAACAAGGA
GTACCTGGAGTTCCGGAAGGAACGGAGCAAGATGCTGCTGTCCAGGAGAAACCAGTTGCTTCTGGAGTTCAGCTTCTGGA
ATGAGCCACAGCCCCGAGCTGGCCCCAATATCTATGAGCTGAGGACATATAAACTCAAGCCAGGAACCATGATTGAATGG
GGAAACAACTGGGCTCGGGCCATCAAGTACCGTCAGGAGAACCAGGAGGCGGTGGGAGGCTTCTTTTCACAAATAGGAGA
GCTCTACGTGGTACACCACTTATGGGCCTACAAAGATTTGCAATCTCGGGAGGAGACTCGAAATGCGGCCTGGAGAAAGA
GGGGCTGGGATGAAAATGTCTACTACACAGTCCCCTTGGTTCGACACATGGNGTCACGAATCATGATTCCTCTGAAGATT
TCTCCTCTACAGTGAAGCTGGCACTGCCTCCACCTCCTTCCCTTTCTCCTGTGGACTAGCCTGGAAAGGAGGCGCTTCTA
GG
Sequence Type mRNA
Unitrap ID UNI24295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4788881..4793254 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]

 
Come back to gene ENSMUSG00000034285


For any suggestions or comments, please send an email to unitrap@crg.es