Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST225403
Clone ID OST225403
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST225403
Sequence
ACTGAGTTCATTGTGATGACATGGCATCTGCCAGCTCCAGCCGGGCAGGAGTGGCCCTGCCTTTTGAGAAGTCCCAGCTT
ACCCTGAAAGTGGTGTCAGCAAAGCCCAAGGTGCACAACCGCCAGCCCAGAATCAACTCCTACGTGGAGGTGGCAGTGGA
TGGACTCCCCAGCGAGACCAAGAAGACGGGGAAGCGCATCGGGAGCTCTGAACTGCTCTGGAATGAAATCATCGTTCTGA
ATGTCACAGCCCAGAGTCATTTGGATCTGAAGGTCTGGAGCTGTCATACCTTGAGGAATGAACTACTGGGCACTGCCTCT
GTCAACCTCTCCAATGTCCTGAAGAACAATGGCGGCNAAATGGAGAACACACAACTGACCCTT
Sequence Type mRNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109976877..110007253 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es