Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST225265
Clone ID OST225265
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST225265
Sequence
CATCATTTGCTCTCTCTNAGGCCCANCATGCACNCCANAGNCATGAGCAATTGTNCATCCCCGNCCAAANGTGGNTGNGA
AATGGTGTGAAAGCTTNANAAGGACGACTAGCACANACACCCCNTNTTNTGNANAACATANTCTGAATAAANTANCTCGN
CATGTGNTGNAGCAAAGCCAGAAGGGTAAAACNCAANAGATCATNNTCCAACAGNCCACAGACTGCAGTCACCGCTGGCC
AGACTCAGACACAACAACAGATTGCTGTCCAGGGACAGCAAGTGGCCCAGACTGCTGAAGGACAGACTATTGTCTACCAA
CCAGTTAATGCAGATGGCACAATTCTCCAGCAAGGCATGATCACCATCCCAGCAGCCAGTTTGGCAGGGGCACAGATCGT
TCANACAGGAGCCAATACCAACACAACCAGCAGTGGACAAGGGACGGTCACTGTGACACTGCCTGTGGCAGGGAAANGTG
GNCGACTCAGGAGGAATGGTCATGATNGNACCAGGAGCTGGCNNTGTGCCTGCTATTCCAAAGAATCCCTTTTACCTGGG
ANCAANAGATGCTTGGAAGGAAGAGCCCCTTGTTTGTGNAATGCCCAAACAGTATCCCCGCATCCCTTAAAGAAGAAAAC
AAGCCCGGGCTTAAGGCTAGAGGCA
Sequence Type mRNA
Unitrap ID UNI23371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48531228..48760268 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es