Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH141
Clone ID CSH141
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH141
Sequence
AGGCAGATCGGGAACCGGGACACACTCTGGGGACTCTTCAATAATCTCCAGCGCCGGCCTGGCTGGGTGGAGGTCTTCAT
CCGGGCACTGCAGATCTGTGAGCTGCCTGGGCTGGCTGATCAAGTGACTCGAGTTTATCAGAGCTACCTGCCTCCGGGGA
CCTCACTCCGCTCCCTAGAGCCACTGCAGTTACCAGACTTTCCTGCTGCGGTTTCTGGACCCTCTGCATTTGCGCCAGGT
CACAACATCCCTGACCATGGCTTACGAGAGACACCAAGTTGCCCCAAGCCTGTCCAGGACACCCAGCCACCAGAGTCCCC
AGTAGAGAATTCAGAGCAACTCCTCCAGACCAACTCCGGGGCCGTCGCGAGGATGTCTGGTGGCTCTTTGATACCCTCTC
CTAACCAGCAGGCTCTCAGCCCTCAGCCCTCCAGAGAGCATCAAGAGCAAGAACCAGAACTGGGTGGCGCCCACGCAGCA
A
Sequence Type mRNA
Unitrap ID UNI5915

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131066072..131069008 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037523 (D430028G21Rik) NM_144888 RIKEN cDNA D430028G21 gene Gene [Source:MGI Symbol;Acc:MGI:2444773]

 
Come back to gene ENSMUSG00000037523


For any suggestions or comments, please send an email to unitrap@crg.es