Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH142
Clone ID CSH142
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH142
Sequence
GAGTGGACCAAGCTCTGCCTCAAGAGCGACGGGCGCCTGTCACTCCTTCCTCAGCTTCTCGATACCACCGCCGAAGGTCC
TCAGGGTCTCGAGATGAACGTTATCGGT
Sequence Type mRNA
Unitrap ID UNI5916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9505825..9505932 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es