Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224927
Clone ID OST224927
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224927
Sequence
GACTGAGGCTTCCATGGATCTCANTAGTGCCAGCTCTGTGGTTCTTCAGGTCCTANCACAGGCCACCAGTCAGGANACTT
GCTGTGTTGAAGCCAGCCGAGGAGCAACTGAAACAGTGGGAGACACAGCCAGGTTTCTATTCAGTGTTGCTGAATATTTT
TACGAATCACACCCTTGATATAAATGTACAGGTGGCGTTGCTGTGCTGTATTTTAAACATGGGATTGATCGTTACTGGAG
GCGTGTCGCACCGCAGTCAAGCCTGAATTTAAGAGCAGATTCATTGTGAAGATTTGCTATATGGACTGATTGTGTGCNCA
GTGCATCTGTGAAGTAGGCCACATGGCCTTCCCTTCGTTGCAGGACCTGGTGCCTTCTTCTACAGCCAACACTTTTGTTT
CCGTTTTCTGNGNTGAAGATTTTTCAAAATTAAATTCACATTGTTGGTACTATTTGG
Sequence Type mRNA
Unitrap ID UNI7597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107708079..107715238 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es