Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224850
Clone ID OST224850
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224850
Sequence
TGCTCGTGGCCCTCATGGACGTGGTGGANGNGGAGACTCCCTAAATCCCAGCTGTNGGATNNTGAGCTTCNGACCTTCCA
TGGAGGANNNTCGGGAGCCAACAGATNCCTCGCATNNATGGAATCCAGAGGAGCCATCGAGCAGGTCTTGCCNGGGTGAC
NCTCNCCNGGGCGNGNCCGCCANAGNNCGTGCCNNTGCTGCNCNTGCNACNTTGCCCCNTCCCCGCACCNANTTCNGCAN
ANTGGTCNCAGNGGCAGTCGGGNCNTGTTCACGCAACTACAACANTCCAGNNGANAAGCCANTGACCTGTGAAGGAGTTC
AGGCAGCCTGGCNTAACAGCAGCAAATACTGTACTCCAAGATACTTGGATTATGAAGATTTGGAACGCAAATACTGGAAA
AACTTAACTTTTGTGGCACCTATTTATGGAGCAGATATAAATGGGAGCATTTATGATGAGGGNGGGGAAAGANTGGCTAA
ATGGTTAGGAA
Sequence Type mRNA
Unitrap ID UNI20034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73908721..73926916 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]

 
Come back to gene ENSMUSG00000028397


For any suggestions or comments, please send an email to unitrap@crg.es