Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224761
Clone ID OST224761
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224761
Sequence
ANTATNCGANCNGGAANCGGNTNCCCTACCCCTTNCCTTCATAACGAGGAGTAGGAACNAATAGAANTNGAGCCCTTGCT
CAAGANGATGANCTNNNANCCAAGGACAGGGAGCCTGGGCCTGAAGAATGAGGACGTNGAGGCTTTGCAGCAGCAGCAGA
CGAGGCTAATGAAGATCAACCATGACCTTCGGCACCGGGTCACCGTGGNGGAGGCCCAGGGGAAAGCCCTGATTGAGCAG
AAGGTGGAGCTCGAAGCAAACCTGCAGACCAAGGAGCAGGAGATGGGCAGCCTGCGGGCTGAACTANGAAAGCTTCGCGA
GAGGCTGCAGGGCGAGCACAGCCAGAATGGGGAGGAGGAGGAAGCTTGA
Sequence Type mRNA
Unitrap ID UNI17672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124964531..124965583 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029392 (Rilpl1) NM_021430 Rab interacting lysosomal protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922945]

 
Come back to gene ENSMUSG00000029392


For any suggestions or comments, please send an email to unitrap@crg.es