Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224711
Clone ID OST224711
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224711
Sequence
GAAGAACTCCCTGAAGGACTGTGTGGCAGTGGCTGGCCCCCTGGGGGTCACACACTTCCTTATTTTGACCAAAACAGATA
ACAGNGTATACCTTGAAGCTGATGCGGCTCCCAGGAGGNCCCACTTTGANGTTCCANATCAGCAAGNATACACTGGATAC
GGGGACGGGGNNTCTTCCNTGCGCCGACACCGGATGCNCGAGCAGNAGTTNAACCACCCTCCCCTCCTGGNGCTCAACAG
CTTCGGCCCCCAGGGCATGCACATCAAGCTCATGGCCACCATGTTCCAGAACCTGTTCCCGTCCATCAACGTGCACACGG
NGAACCTGAACACCATTAAGCGCTGCCTCCTCATTAACTACAACCCTGACTCCCANGAGCTGGACTTCCGACACTACAGC
GTCAAAGTGG
Sequence Type mRNA
Unitrap ID UNI24328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20693790..20695159 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004100 (Ppan) NM_145610 peter pan homolog (Drosophila) Gene [Source:MGI (curated);Acc:Ppan-001]

 
Come back to gene ENSMUSG00000004100


For any suggestions or comments, please send an email to unitrap@crg.es