Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224651
Clone ID OST224651
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224651
Sequence
ATGATTGAGAAAAGTAAGCAGCTGGCAGCAGCCTTCCAAGGAGGAGTTCACAGTGCGAGAGGACCTGATGGGTCTGGCAG
ATCGGAACGCACGGTGCCAACATCCAGCAGGCTNGGAAAGTGCCCGGAGTGACTGCCATTGAGTTGGGTGAAGAGACCTG
CACTTTNCGAATCTATGGGGAGACACCANAGGCATGCAGACAGGCTCNAAGCTACCTNGAATTTTCCNAGGACTCTGTAC
ANAGTGCCCTGGAACCTGG
Sequence Type mRNA
Unitrap ID UNI7317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69462302..69462727 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018765 (Fxr2) NM_011814 fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI (curated);Acc:Fxr2-006]

 
Come back to gene ENSMUSG00000018765


For any suggestions or comments, please send an email to unitrap@crg.es