Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224315
Clone ID OST224315
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224315
Sequence
CTGGCGACCTGTTTAGGAGTCCAATAAACGTCCCAACACGCACAGNATGGGNAGTAGCAGGATTNANCATANGGTAAGNC
GGCTGCAACACAGGTGNTACTTCTNTTTACTATCTANACTGATAGCNCTNTCACCTTCCTTCCNTGAGGGAAGAGTAGGN
ACCTGANTTNNAGTGGNACNAGGGAGCTCTNTNNGTGNNGCNGNAGCNTGNCAAGAGTATACAGGAATCATACTTGGCAC
TGCCTACCNCTTTCGCTGNTTCAAGCTTNTATNTGATTATTTTACACAATANCATTACNGGAGTTAATGTTCTTTTCTTA
ANANTTNGNCACTCANACNAAGAGGANGAGGAACAACCTCGGCNCCGTGGACAGCNCAAACGGGCCAGCCGTGACCAGGA
CTCGTCAGATGATGAGCGAGCCCTGGAAGACTGGGTATCTTCAGAGACAACAGCCTTACCCCGACCTCGCTGGCAAGCCC
TTCCTGCGCTTCGGGAGCGGGAACTGGGTTCCAGTGCCCGCTTTGTGTACAAGGCTTGTGGAGCTAGAGTCTTTGTACAG
CGTTTCCGTTTGCAGCACGGGCTTGGAGGGCCATACTGG
Sequence Type mRNA
Unitrap ID UNI10040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 174096037..174102970 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026554 (Wdr42a) NM_153555 WD repeat domain 42A Gene [Source:MGI Symbol;Acc:MGI:91860]

 
Come back to gene ENSMUSG00000026554


For any suggestions or comments, please send an email to unitrap@crg.es