Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224314
Clone ID OST224314
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224314
Sequence
CCATGGCAACCCCAGNTGTGAGCGTCCACATGGNAGGNAGGTGGTGGTTGTGACAACTCCAGCACACTGCAGTTGATGGC
AGTGGTGTAGAGGAAGTGAAGACAGTGCTTGTAACAACGAACCTAGCTCCTCATGGGGGTGATTTGACAGAAGATAACAT
GGAAACAGAAAATGCAGCAGCTGCAGCTGCTGCTGCTTTTACAGCCTCCTCACAGCTCAAGGAAGCCGTGTTAGGTAGGA
AACCCTATTGGCTGGAAAGATGTATTAGGTGGGAAGCCTGCCTTCTGCCTACTCTTGGTTGCAGAGATTGGACAGTCCAN
AAATTGAGGTAGCAGCCAAGGCTAAGCAGGTTGTTCCCCAACATATAANAGATCAGGTCCTGGATCTTCTTAAGGAGGAG
GGTCACACTGTATCTGAAATAAGAACTACTTCTACCAGCCACTGATGGAAAAAAGAA
Sequence Type mRNA
Unitrap ID UNI21290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181000297..181012786 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es