Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH204
Clone ID CSH204
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH204
Sequence
GTGGCGAAGGCGCTACTTCCGACTGGCGCAGGTCGAGCTACCGGCAGCCGCTTCTCACCGGATCCCGTGCTATCTCAGCC
ATGGGCAAAAAGCACAAGAAGCACAAGGCGGAATGGCGCTCGTCCTACGAAGATTATACAGACACGCCACTGGAGAAGCC
TCTGAAGCTGGTGCTCAAGGTGGGAGGAAGTGAAGTGACAGAGCTCTCAGGATCTGGCCACGACTCCAGCTACTACGACG
ATCGCTCAGACCACGAACGGGAGAGACACAGAGAAAAGAAGAAAAAGAAGAAGAAAAAGTCAGAGAAGGAGAAGCACCTC
GATGAGGAGGAGAGGAGGAAGCGGAAGGAAGAGAAGAAACGGAAACGGGAGAAGGAACACTGCGACTCAGAGGGGGAGGC
TGATGCTTTCGACCCTGGAAAGAAGGTGGAGGTGGAGCCACCCCCAGACCGACCAGTGAGAGCCTGCCGAACACAG
Sequence Type mRNA
Unitrap ID UNI5930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74075262..74076441 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057649 (Brd9) NM_001024508 bromodomain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2145317]

 
Come back to gene ENSMUSG00000057649


For any suggestions or comments, please send an email to unitrap@crg.es