Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST224118
Clone ID OST224118
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST224118
Sequence
CATTCTGTGCTTTCTTGCTTCAGTACTTTACAACTGCAGGCCAACCCAGTCTGGCAAGCACTTTTTATTAT
Sequence Type mRNA
Unitrap ID UNI24232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35070880..35070944 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

 
Come back to gene ENSMUSG00000066571


For any suggestions or comments, please send an email to unitrap@crg.es