Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST223998
Clone ID OST223998
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST223998
Sequence
AGACTGAGGTCTGAACAGCAGCTAAAATACATCCATAAAGNCNATCCTGCAGGCNATTAACATCCGTCCCNTTTCTACAG
GGAATAGGTCACCCCGGTACCGACTGCTCATGAGTGATGGGTTGAACACGCTTNTNTCGTTCATGCTGGCCACGCAGCTG
AACACCCTGGTCGAGGGAGGGCAGCTGGCCAGCAACTGTGTCTGCCAGGTCCACAAGTTCATCGTCAACACCCTGAAAGA
CGGCAGGAANGCACTTCCTTATCCACTCGCTTGCACTGTA
Sequence Type mRNA
Unitrap ID UNI24131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75153758..75155701 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es