Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH268
Clone ID CSH268
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH268
Sequence
AAACCACTGTTACCTAATATTTAGGAACCTGTGCCAGATGCAGGAGGACAACAGCAGCTTCTCGCTGCTTCTGGACCTTC
TCTCCGAGCTGTATCAAAAGCAACCCAAGATCGGCTACCACCTGCTCTACTACTTGAGGGCAAGCAAAGCCGCCGCAGGG
AAGATGAACCTGTATGAGTCGTTTGCCCAGGCTACCCAGCTGGGTGATCTGCACACCTGTCTAATGATGGACATGAAGGC
CTGCCAAGAGGATGATGTGCGACTGCTATGCCACCTCACACCTTCCATCTACACAGAGTTTCCAGATGAAACTTTGAGGA
GTGGGGAGCTGCTGAACATGATTGTGGCTGTTATTGACTCTGCACAGCTCCAGGAGCTGGTCTGCCATGTGATGATGGGG
AACCTGGTCATGTTTCGGAAGGACTCAGTCCTCAACATACTCATTCAGAGCCTAGACTGGGAAACGTTTGAGCAGTACTG
TGCCTGGCAGCTCTTCCTGGCCCACAACATCCCCTTGGAGACCATTATTCCTATTCTCCAGCACCTCAAATACAAG
Sequence Type mRNA
Unitrap ID UNI5945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90197997..90204347 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es