Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH275
Clone ID CSH275
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH275
Sequence
GGGGAGGAGCGGAAGCCGCTGGCCGGGGACAGACTCCCGCGCCTGTGAGCCGCGGTGCAGGCAGAGCGCGCGCCGGGACC
AGCCCGCGGTCGGCCCTCCCGGAGGACGGCAGCCGCTCTC
Sequence Type mRNA
Unitrap ID UNI5949

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15940879..15940998 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041153 (Osgin2) NM_145950 oxidative stress induced growth inhibitor family member 2 Gene [Source:MGI (curated);Acc:Osgin2-001]

 
Come back to gene ENSMUSG00000041153


For any suggestions or comments, please send an email to unitrap@crg.es