Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST223276
Clone ID OST223276
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST223276
Sequence
GACTGAGCCCAGTCATTGGCATCATGAACTGGAATAAAGGCGGCCCTGGAACCAAGCGGGGNTTTGGTTTTGGAGGTTTT
GCTATCAGTGCTGGGAAGAAGGAGGAAGCCAAACTGCCACAGCAGTCCCATAGTGCCTTTGGGGCAGCCAGCTCTTCTTC
TGGATTTGGAAAGTCTGCTCCACCACAGCTTCCTTCTTTCTACAAAATTGGATCTAAACGGGCCAACTTTGATGAAGAAA
ATGCGTATTTTGAAGATGAAGAAGAAGACTCCAGCAATGTAGATTTACCTTACATTCCTGCTGAAAACTCACCTACCCGC
CAGCAGTTCCATTCCAAGCCCGCAGACTCTGACAGTGATGATGACCCCTTAGAGGCATTCATGGCTGAAGTGGAGGATCA
GGCTGCTAGAGACATGAAGAGACTTGAAGAAAAGGACAAGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI6873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106085397..106090129 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es