Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST223227
Clone ID OST223227
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST223227
Sequence
ACTGAGGAAACCAGTGAAATGGAGTAGTNTGCACTCNCGCCNTNAGACGCTGCAGGANGACCCCTCGGGGGNGTCGCCNT
GCGGATAAAACGNCTNNTTAGANCCCCCACGTTCNNCCTTNTCCNNAGCCTGCCNAATCCAAGGANACCTGTGTCGAAGC
NTGANTGCTGGTACAGCCTTCTGCCCGCNCCTCCAGCCCACCTTGACAGGGATCCTNCNCNTTNGGNNGATTACAGTTAC
CTAANGAAACAGGTCTAGGTCTGAAGANCCTAGGCGGAATTAACAGGAATGAAGGACCGCTGGTGTATATTCACGAAGTC
ATTCCTGGAGGTGACTGTTACAAGGNAAACAACTCCACATGCCCCACCACACCCCCCANAAGCCAGTAATGACAAAATCC
CACCGATGCCAAGATTCGAATTTTCTTCATCAGTAAATTTTTCATATAAGTTTAACGTCCTCAATGAAANATACAAGGGG
ACCTTTACCCTCAAGGATGTTTGCCCTAAAAATAAATTCTCCAAGTATGCAGATAA
Sequence Type mRNA
Unitrap ID UNI24371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90480305..90483577 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020546 (Stxbp4) NM_011505 syntaxin binding protein 4 Gene [Source:MGI (curated);Acc:Stxbp4-001]

 
Come back to gene ENSMUSG00000020546


For any suggestions or comments, please send an email to unitrap@crg.es