Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST223193
Clone ID OST223193
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST223193
Sequence
TAATTCAACATGGCGACTATGGTTCCACCAGTGAAACTGAAATGGCTTGAACATCTGAATAGCTCCTGGTTCACAGGAGG
ACAGTGAATCTNTNNANTCNCGTNANNNNGANTATGATATTNNANGTAATAAGCAGTATCATATGATANNTTNTANGACC
TTACNCNTCTGAGCTGNAATGCCTTNGAGNACCANNNNTGNNTGTTTGAATTTCGTGNGTCTCTTTCAAGNGAAGANCAN
GACCATTNTTTGGATGCCCTTCTTAGCAGCCAGCTAGCACTANCAAAGATGGTATGTTCAGATTCTCCATTTGCTGGGGC
GCTAAGAAAACGACTGCTTGTACTCCAACGTGTCTTTTATGCACTTTCTAATAAGTACCATGACAAAGGCAAAGTGAAAC
AGCAGCAGCANTNCTCCGNAAAGCANCTCTGGTTCAGCAGGATGTCCATTTCTGTNAGTGAACGCCCCCGGTCAAGCACT
GATGCNCTTATAGAAATGGGTG
Sequence Type mRNA
Unitrap ID UNI16525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66219610..66220102 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es