Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST223185
Clone ID OST223185
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST223185
Sequence
ATGGTGTGAATATTTACCGCAGTCACTGAAGTGGACCCCTGTGACATTGTTGGACAGTTCTACCATCCAGATCAGAAAGG
TCAGCTCAATGTATGTGGGTGAATACTGGGCTTGTGTGCCCAGGACAGCAGCCTTTGTGTAAGCTTCAGAACCCAGATCG
ACGGGCTGTTATAGCTGATGTGCATGGTCTCTTAGTCCTTCTNACCCCTGCCTTTCTCATCCACTGCCCTTTCCTCTTCT
TTTCTCCCCTCTCTCTTTTTGTCTTCTTGCCGGAAGCCAAGCATAAGGCCTTATGCATACTAGACAGGCGCTCTCCAGCT
GAGCTCCGTTCCAGCACTTGCTTTTTTTTTTTTTTTTTNAANTTAANGGNNANNNGGGTNNNCCCTCACACCCTTTTTTG
G
Sequence Type mRNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24326614..24326967 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es