Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH312
Clone ID CSH312
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH312
Sequence
GGCCTGACTACCAGAAACATGGCGACCAGCGCTGTTCCAAGTGAAAACCTTCCCACATATAAACTAGTAGTGGTGGGAGA
TGGTGGTGTGGGCAAGAGTGCGCTCACTATTCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAAG
ACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTGGAT
Sequence Type mRNA
Unitrap ID UNI5955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99311813..99312022 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es