Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222939
Clone ID OST222939
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222939
Sequence
GCTTCTCAGCAGTCCAGTCCAATCCAGNACACAGCGCACTGCCAGNAGCAAAGNAGGAAATACTCGGAGGTTGATGATAG
CTTGCCTTCAGGAGGAGAAAAACCATCAAAGAATGAAACCGGCTTATTGTCTTCAATTAAAAAGTTCATTAAAGGAAGCA
CACCCAAGGAA
Sequence Type mRNA
Unitrap ID UNI22158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121794851..121795016 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es