Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH335
Clone ID CSH335
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH335
Sequence
CATGCAGGCTCTTGGGGAAGCTGGTGCTGCTGCTGCTGTGTGATTACCGCGGACAGACCTTGGGACCGAGGCCGGCGCTG
GCAGCTGGAGATGGCGGACACACCGTCAGTGTATGAAACCAGATTTGAGGCGGCCGTGAAGGTGATCCAGAGTTTGCCGA
AAAATGGATCATTCCAACCAACAAATGAAATGATGCTTAAGTTCTATAGCTTCTACAAACAGGCAACTGAAGGACCCTGT
AAACTTTCACGGCCTGGATTCTGGGATCCTATTGGAAGATATAAATGGGATGCTTGGAGTTCACTGGGTGATATGACTAA
AGAAAGAAAGCCATGAATTGCGATATGTTGA
Sequence Type mRNA
Unitrap ID UNI5962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22924974..22933723 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es