Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH363
Clone ID CSH363
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH363
Sequence
TAAAGAACCGGAGAGCTGGACGAAAATCCCAGCAACTGTTTGAGAACTCCTTGGACTCTTTGCACAGGATGTGGAGTCCC
CAAGACAGGAAGTACAACCACCCACCCATGCAGCTGTCCCTGAAGTCCAACAGCCAGTCCCTGCGCAGTGGGAACTGGTC
AGAAAGGAAGAGCCATCGTTTGCCACGATTACCCAAGAGGCATAGCCATGATGACATGATGCTGTTGGCTCAGCTGAGCC
TGCCATCTTCACCCTCCAGCCTCAATGAGGACAGCCTCAGCACCACAAGTGAGCTGCTGTCCAGCCGCAGGTCCCGCCGC
ATTCCCAAGCTTGTCCAAAGAATTAACTCTATCTATAATGCCAAGAGAGGAAAGAAGAGGTTGAAAAAGCTGTCTATGTC
CAGCCTTGAGA
Sequence Type mRNA
Unitrap ID UNI5972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116684865..116688703 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es