Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222361
Clone ID OST222361
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222361
Sequence
ACTGCTGTTCTCACATTCCATTGCCTGTGGCACATGCTTCTATGCAAGCCTCTTTTGCGTCAATGCAACACCTNTCTACT
GCTTGATGCTGGGGTCAAATTTCCTGGGAAGACACTGGNAGTGAACCTTCTGTGTGAAGCTTTGAAAGNATCCAAACTGC
ACCCTCAAGGAGTTATGGTTGCCTGGTTGCTATTTAACTTCAGAATGTTGTGAAGAGATCTCGGCTGTCCTGACTTGCAA
TACAAATCTAAAGACCCTGAAACTTGGCAACAATAACATACAAGACACTGGTGTCAAACGGTTATGTGAAGCTCTGTGTC
ATCCTAACTGTGAAATGCAGTGTCTTGGGTTAGACATGTGTGACTTCACCAGTGACTGTTGTGAAGACCTGGCCTTGGTT
CTTACCACCTGCAACACATTGAAGAGCTTAAACCTTGACTGGAATGCCTTTGACCATTCTGGGCTGGAGATGCTCTGTAA
GGCCTTGAATCACAAAGCCTGTAACCTGGAGGNGCTTGGACTGGACAAAATCTTTATTTTTNTGAGGAAATCACAAACAT
TACTGCAAGCTG
Sequence Type mRNA
Unitrap ID UNI24392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27089743..27358871 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054102 (Nlrp9a) NM_001048220 NLR family, pyrin domain containing 9A Gene [Source:MGI (curated);Acc:Nlrp9a-003]

 
Come back to gene ENSMUSG00000054102


For any suggestions or comments, please send an email to unitrap@crg.es