Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222212
Clone ID OST222212
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222212
Sequence
GCAGAGCGAGACATCTGGAGGANTATGGGCGTCCCCCGAAGCTGGTANAATNCGNCCAGNNATGGCCCTAGGTTAACAAA
AGGAAAGGGCAAAGCTTAATTGGCTCAGTGTGGACTTCAATAATTGGAAAGACTGGGAGGATGACCTCAGATGAAGACAT
GTCGAATTTTGACCGTTTCTCTGAGATGANGGATCACATGGGTGGNGATGAGGATGGTAAATTTACCAGAA
Sequence Type mRNA
Unitrap ID UNI13400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127507245..127511322 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es