Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222204
Clone ID OST222204
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222204
Sequence
GACTGAGGCAGCCTGCNTCTGCAAAGNGGTACGNGCGAAGGGACTCTGTNGTCNNTGNNCTNTGTGTTGAAGACNGTAAA
GATGTTAATGTAAACTTTGAAAAATCCAAACTTACTTTCAGTTGTCTTGGAGGAAGCGATAATTTTAAGCATTTAAATGA
AATTGATCTTTTTCATTGTATCTGATCCAAATGATTCCAAGCATAAAAGAACAGACAGANCGATTTTATGTNGTTTGCGA
AAAGGAGAATCCGGCCAGTCATGGCCTAGGTTAACAAAGGAANGGGCNAAGCTTAATTGGCCTCAGTGTGGACTTCAATA
ATTGGAAAGACTGGGAGGATGACTCAGATGAAGACATGTCGAATTTTGACCGTTTCTCTGAGATGATGGATCACATGGGT
GGTGATGAGGATGGAAATTTACCA
Sequence Type mRNA
Unitrap ID UNI3534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127505726..127511319 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es