Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222140
Clone ID OST222140
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222140
Sequence
GACTGAGGAAGAAGATGAGCCTGAAGTCCGAACGCAGGGGAATTCATGTGGATCAATCTGAGCTCCTGTGCAAGAAAGGA
TGCGGTTACTACGGCAACCCTGCCTGGCAGGGTTTCTGCTCCAAGTGCTGGAGGGAGGAGTACCACAAGGCCCGGCAGAG
GCAGATCCAAGAGGACCTGGGAACTGGCAGAACGGATATTGAANNACNCTGCNAACCTCANGATTGAGNNTATTTACTNA
AAANAACTGTTGGGCTGNCANGATGNCNCAGNCTGTAGNANTACTGATCAGCTCTTTCTGANCATNCTGAGTTCAAAGCC
CTTGCAACCACCCGTAATGATGATCTGACGCCCTCTTCTGG
Sequence Type mRNA
Unitrap ID UNI16716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130663269..130663945 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]

 
Come back to gene ENSMUSG00000025340


For any suggestions or comments, please send an email to unitrap@crg.es