Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST222102
Clone ID OST222102
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST222102
Sequence
CTGAGAATTCTGCATAGAGAATNACCAACCCAGAACCATGGAAGTCCATGAATTGTTCCGGTATTTTCTAATGCCAGAGC
TGATTGACATTCGGCAGTACGTGCGCACCCTTCCAACCAACACCCTCATGGGGTTTGGGGCTTTTGCAGCGCTCACCACC
TTCTGGTATGCCACCAGGCCTAAGGCCCTGAAGCCACCATGTGACCTCTCCATGCAGTCAGTGGAAATAGCGGGTACCAC
TGATGGTATTCGAAGATCAGCAGTCCTTGAAGATGACAAGCTCTTGGTGTACTACTACGACGATGTCAGAACCATGTACG
ATGGCTTCCAGAGGGGGATTCAGGTGTCAAATAATGGTCCTTGTTTAGGTTCTCGGAAGCCAAACCAGCCCTATGAGTGG
ATTTCCTACAAANAGGGGGCAAAACCTGGCCNGAGNGCATAGGCCTCCGGGCCTGATCCAAAAGGGGTTCAAGCCTTG
Sequence Type mRNA
Unitrap ID UNI24400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 47578152..47596772 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018796 (Acsl1) NM_007981 acyl-CoA synthetase long-chain family member 1 Gene [Source:MGI (curated);Acc:Acsl1-001]

 
Come back to gene ENSMUSG00000018796


For any suggestions or comments, please send an email to unitrap@crg.es