Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH410
Clone ID CSH410
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH410
Sequence
CCACGTGGGGTCCTATGGTGACACTGGGCACCTTTTCACAGAGAGCTGCAGCATCTCTCCCAAGCTCCGTTCCATCGCTG
TCTACTATGACAACCCCCATACGGTGCCTCCTGAGAAGTGCCGCTGTGCAGTCGGCAGCATCCTGAGTGAGGGGGAGGAG
TCGCCTTCACCTGAGCTCATCCACCTCTATCAGAAATTTGGCTTCAAGATATTCTCCTTCCCAGCACCTAGCCATGTGGT
CATAGCTACCTTCCCTTACACCACCCCCATATCCATCTGGCTGGCTGCCCGCCGAGTCCATCCTGCCTTGGATACCTACA
TCAAGGAGCGGAAGCTGTGTGCTCACCCTCGCCTGGAGATCTACCAGCAAGACAAGATCCATTTCATGTGCCCACTGGCA
AGGCAAGGAGATTTCTACGTGCCAGAGGTGAAGGAGACAGAGCGGAAATGCCGGGAGCTTGCGGAGGCCACTGACACCCA
GACGGATGGCA
Sequence Type mRNA
Unitrap ID UNI1266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106564694..106584301 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040813 (Tex264) NP_035703 testis expressed gene 264 Gene [Source:MGI Symbol;Acc:MGI:1096570]

 
Come back to gene ENSMUSG00000040813


For any suggestions or comments, please send an email to unitrap@crg.es