Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221673
Clone ID OST221673
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221673
Sequence
CAAAGATGGAGCATTTTTTGGCTTGAATAATAATGGAANAATTAGAACTGGAACATAATAACCTTACAGGAGTGAACAAG
GGGTGGCTATATGGCTTGNGAATGTTACAGCAACTGTATATGAGCCAGAATGCTATTGAAAAAATCAGCCCCGNTGCATG
GGAGNTCTGGCCAGAGACTGTCTGAACTGGATTTGTCCTATAACCAGCTGACCCGCCTTGATGAAA
Sequence Type mRNA
Unitrap ID UNI24419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104294560..104295375 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es