Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221455
Clone ID OST221455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221455
Sequence
CTCATAAAACCGTGTTTGTTGTGGCNCACCTGCCCCTTANCCTGGCAGCGTCCCTGTAGGCAGCACTGTGGCGTTTGCTN
TGCTGGTGANGCNCAGGACCCAAGGCNTCATCCCTTTTGGCCTCCCCTCTCCAAATCCTTGTGGACTTGCTCAGTAGAAT
CTTCCNTGGAATATTGTAGAATAATGTATGACATATTTCCTTTCAAAAAGCTGGTGAATTTCATTGTTAGTGATTCGGGA
GCACATGTTTTAAATTCTTGGACTCAAGAAGACCAAAACTTACAGGAGCTAATGGCAGCACTAGCTACAGTGGGGCCTCC
TAACCCTCGGGCAGATCCAGAGTGCTGCAGCATCCTGCATGGTCTTGTTGCAGCAGNGGAAACCCTTTGCAAGATTACCG
AATACCAGCATGAGGCTCGCACTTTACTCATGGAGAATGCAGAACGAGTTGGGAATAGAGGACGGATAATCTGCATCACA
AATGCAAAAAGTGATAGTCATGTCCGAAT
Sequence Type mRNA
Unitrap ID UNI4258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146514213..146524952 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040250 (4933424B01Rik) NM_138757 RIKEN cDNA 4933424B01 gene Gene [Source:MGI Symbol;Acc:MGI:1918427]

 
Come back to gene ENSMUSG00000040250


For any suggestions or comments, please send an email to unitrap@crg.es