Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221417
Clone ID OST221417
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221417
Sequence
CGATTATGAGACCACTGNCAAGTGNCTGCTGCNCCACACTGAATATNGGACCTCAAGCGGCAGCGATCTGCGGNTCCNGG
ATCATGAGGNNTGACTGNTNACTCAAANGNNGGTNAGATNTTNCGACTACCNNCGAGATCCCTNCGTNNTCCCTNNAGAC
GAGTNGCNGNGTCANNGCNNNNCCGCNNCGGTNANCTNGATNTNCNTGCCCNNGCAGACTGNCTGTGTGCNGCATGCAGA
GCCCGGTTCCCCNNCTGTACTGCGNGGCATNCTCCCCTGTCAAANNGTGANANTTCCCANGTGAGACGTTTTCCCATCTT
CTGGGTGTGGAANCCTTTGGTGGTCACCAATGCTGCTGGAGGACTCAACCCTAATTTTGAAGTTGGAGATATTATGCTGA
TCCGTGATCACATCAACCTACCTGGTTTCTGTGGCCAGAACCCTCTCCGGGGCCCCAACGATGAAAGGTTTTGGAGTTCG
TTTTCCTGCCATGTCTGATGCTTATGACCGGGATATGAGGCAGAAGGCTTTCACTGCCTGGAAACAAA
Sequence Type mRNA
Unitrap ID UNI24423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 51567540..51570586 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021871 (Pnp1) NM_013632 purine-nucleoside phosphorylase 1 Gene [Source:MGI (curated);Acc:Pnp1-001]

 
Come back to gene ENSMUSG00000021871


For any suggestions or comments, please send an email to unitrap@crg.es