Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH454
Clone ID CSH454
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH454
Sequence
CGCCGCGGAGCGCAGCCGCCGGCCCTCGGAGACGTCGGGCAGTGCGGGGAGGCGCGGCCACCGGCGGGATGTGGTAGCAC
GTGACACCGGCCCCATCGCGCACCTAGCAGCCGCCGGCCCCCTGCCCTGGACGTGCAGGATGAATGACATGAACTTGAGC
CCAGTGGGGATGGAGCAGCTGTCTTCATCCTCTGTGAGCAATGCCCTGCCAGTCTCAGGAAGTCACCTGGGCTTGGCTGC
CTCTCCCTCTCACAGTGCCATCCCTGCCCCAGGACTTCCAGTGGCAATTCCAAACCTGGGTCCCTCCCTGAGCTCTCTGC
CTTCTGCCTTGTCTCTTATGCTCCCCGTGGGCATTGGAGACCGAGGAGTGATGTGTGGGCTACCTGAGAGGAACTACACC
CTACCTCCACCTCCTTACCCTCACCTAGAGAGCAGTTACTTCAGAACCATTCTACCT
Sequence Type mRNA
Unitrap ID UNI5827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 85372969..85379406 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035529 (Prdm4) NM_181650 PR domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1920093]

 
Come back to gene ENSMUSG00000035529


For any suggestions or comments, please send an email to unitrap@crg.es