Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221345
Clone ID OST221345
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221345
Sequence
AAAGCTGTTCCCGGTGTACGGCAGGAACCTGGGNGTCCGTGAACCTCCCAGNCTTTACAGGGCAGNAGCTCAGCTCCTGA
GGNCAGGGAGGTCTCTGGAGGAAGGAGAAACACACCCTCATGAACAAAGCCTCCAAGTATGAGAAAGAGCTAAAGCTGCT
TCGACATGAGAACCGGAAGAACACGCTCCTCTCGGTGGCCATCTTCACTGTCTTCGCCCTGCTCTATGCTTACTGGACTA
TGTGAGTCAGCCATCTCCAGCCACTAGAAGGACGTGGTAGTGCTTCCTTCTGCTTAGTAGAGGGGCAATAAAGAGCCCCA
GGCTCTGCTGTCTGGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29841218..30826828 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024018 (1110021J02Rik) RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]

 
Come back to gene ENSMUSG00000024018


For any suggestions or comments, please send an email to unitrap@crg.es