Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221322
Clone ID OST221322
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221322
Sequence
AATATTGTGCGAACCCCATCTGTTGCCCAGGATTGGCATCTCGGTGGGAATTGTTGGACAGTCTGGCTCAGCAGACTCCT
GTAGGCAGTGCTGCCGTGTCCTCCGTTGACTCCTTTACGCAGTTCACACAGAAGATGTTGGACAACTTCTACAATTTTGC
TTCATCATTTGCTCTCTCTCAGGCCCAGATGACACCAAATCCATCAGAAATGTTCATCCCAGCAAATGNGGTTCTGAAAT
GGTATGAAAACTTTCAAAGACGACTAGCACAGAACCCCCTNTTTTGGAAAACATAATTTGAATAAAATAACTTGTCATGN
GATGTAAAAGCATGAAGACAAAAGGGTCATGAAACCTACCTTTCAAAAAAAACCTGCTTAGNGACTATGAGACTTATAAA
ACCCTTATAAAAATTANAACTATTGAATGAGGAAAANGGGNCAATATTAATTATTTTCTCCCTTATAAGGGGGACATACT
TTCTTGG
Sequence Type mRNA
Unitrap ID UNI16719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97067274..97072193 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062797 (l7Rn6) NM_026304 lethal, Chr 7, Rinchik 6 Gene [Source:MGI (curated);Acc:l7Rn6-001]

 
Come back to gene ENSMUSG00000062797


For any suggestions or comments, please send an email to unitrap@crg.es